Ethics approval

The experiments were approved by the Medical Ethics Review Committee of Xiangya Hospital of Central South University (Ethics code: 2023121169). Tissue samples were collected from the Xiangya Hospital of Central South University (Changsha, China), and all individuals provided informed consent prior to participating in the study.

Animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) of Central South University (CSU-2023-0462), and all procedures were conducted in accordance with the institutional guidelines of the Animal Care and Use Committee of Central South University. All mice were housed in the Laboratory Animal Research Center of Central South University, which is a pathogen-free animal facility at a controlled temperature under standard laboratory conditions (12 h light/dark cycle, temperature kept at 21–24 °C and 40–70% humidity) with food and water provided ad libitum. Female mice were selected because the study focuses on breast cancer, a disease that predominantly affects females and is influenced by female-specific hormonal and physiological factors. In compliance with ethical regulations, tumor volume did not exceed 2000 mm³, and no single tumor dimension exceeded 20 mm in diameter.

Target prediction of Bufalin based on an integrated multi-predictive strategy

To refine the target prediction range, we trained a deep learning model based on the Chemprop²⁵ package using binding data from 11 targets sourced from ChEMBL and PubChem, with an average of 1187 compounds per target (Supplementary Table 2). The dataset was randomly split into an 80% training set and a 20% test set.

The model employs a Graph Neural Network (GNN) architecture specifically designed to learn molecular representations from graph-structured data. It consists of four primary components: (1) a shared local feature encoder that extracts atom and bond features across all tasks; (2) a directed message-passing process that propagates information along directed edges to generate atom embeddings; (3) an aggregation module that combines atom embeddings into a single molecular representation using sum or mean pooling; and (4) a feed-forward network (FFN) with task-specific multi-layer perceptron (MLP) layers to map molecular embeddings to target properties, enabling efficient multi-task predictions.

The model was trained with the Adam optimizer, incorporating learning rate scheduling, dropout regularization, and a model-ensembling strategy. Together with an advanced GNN architecture and a carefully curated dataset, this results in a robust and high-performing model, achieving a receiver operating characteristic area under the curve (ROC-AUC) of 0.94 on the test set (Supplementary Table 3). Finally, a default probability threshold of 0.8 was applied, ensuring that only targets meeting this performance criterion were selected.

Cell lines and culture

All cell lines were maintained at 37 °C in a humidified atmosphere of 5% CO₂/95% air. MCF-7 cells were purchased from Cell Bank (Chinese Academy of Sciences, Beijing, China). The T47D and 293 T cell lines were purchased from Cell Bank (Chinese Academy of Sciences, Shanghai, China). The Tamoxifen-resistant cells LCC2 were derived from Wuhan University. MCF-7 and 293 T cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, Carlsbad, CA, USA) with 10% Fetal Bovine Serum and 1% penicillin streptomycin. T47D were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) with 10% Fetal Bovine Serum and 1% penicillin streptomycin. Tamoxifen-resistant LCC2 cells were cultured according to the literature⁵², briefly, LCC-2 cell lines were cultured in RPMI-1640 medium (10% Fetal Bovine Serum and 1% penicillin streptomycin). All cell lines were tested negative for mycoplasma contamination.

Reagents and Antibodies

Bufalin was purchased from APExBIO (USA). Fulvestrant, Estradiol (E2), and MG-132 were purchased from MedChemExpress (Monmouth Junction, NJ, USA). MLN4924 was purchased from TargetMol (Washington, USA). The recombinant Human CYP17A1 (cat. no. CSB-EP006392HU) and estrogen receptor (ESR1) (Cat. no. CSB-YP007830HU) proteins were purchased from CUSABIO. Recombinant human PKC delta protein (ab60844) was purchased from Abcam (Cambridge, UK). Antibodies targeting ERα (Cat. no. 8644, WB, 1:1000), LC3 (Cat. no. 12741, WB,1:1000), PARP (Cat. no. 9532, WB,1:1000), and Bcl-2 (Cat. no.15071, WB, 1:1000) were purchased from Cell Signaling Technology (Danvers, MA, USA). The ERα (cat. no. 84564-4-RR, IHC, 1:500, IF, 1:250), STUB1 (Cat. no. 68407-1-Ig, WB, 1:1000), and β-actin (Cat. no. 81115-1-RR, WB, 1:5000) antibodies were purchased from Proteintech (Chicago, IL, USA). The Flag (cat. no. M185, WB, 1:1000) and HA antibodies (cat. no. M180, WB, 1:1000) were purchased from MBL (Tokyo, Japan), while the antibody against ubiquitin (cat. no. sc-8017, WB, 1:200) was purchased from Santa Cruz Biotechnology. Anti-mouse and anti-rabbit secondary antibodies were purchased from Abiowell (Shanghai, China). Streptavidin FITC (Cat. no. 11-4317-87) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). Magnetic streptavidin beads (cat. no. 22305-1) were purchased from Beaver (Suzhou, China). Lipofectamine 8000 was purchased from Beyotime Biotechnology (Shanghai, China). Lipofectamine™ RNAiMAX was purchased from Invitrogen. Protein A/G agarose beads (cat. no. 10121) were obtained from Santa Cruz Biotechnology, and the CCK-8 was purchased from Bimake (Shanghai, China). An enhanced chemiluminescence kit (cat. no. BL520A) was purchased from BioSharp (Shanghai, China).

Plasmid and siRNA transfection

Plasmids encoding wild-type and mutant ERα were obtained from Gene (Shanghai, China), while siRNAs targeting ESR1 and STUB1 were purchased from GenePharma (Suzhou, China). The target sequence of ESR1 siRNA was as follows: GCACCCUCUUGUAUUCCUATT (sense), UAGGAAUACAAGAGGGUGCTT (antisense). The target sequence of STUB1 siRNA was as follows: GCAGUCUGUGAAGGCGCACTT (sense), GUGCGCCUUCACAGACUGCTT (antisense). For siRNA transfection, the siRNA targeting ESR1 or STUB1 was incubated with Lipofectamine™ RNAiMAX in serum-free medium according to the manufacturer’s instructions. The plasmid was transfected using the Lipofectamine 8000 reagent in serum-free DMEM, according to the manufacturer’s instructions.

Western Blot

After treatment, the cells were washed twice with cold PBS and lysed on ice for 30 minutes in RIPA lysis (‌Abiowell) supplemented with a protease inhibitor cocktail (Biotool), followed by centrifugation at 12,000 g for 15 minutes at 4 °C. The protein concentration of the supernatant was determined using BCA. Proteins were resolved by SDS-PAGE and then transferred to PVDF membrane (Merck KGaA, Darmstadt, Germany). The PVDF membranes were blocked with 5% skim milk for 1 h at room temperature and then incubated with the respective antibodies at 4 °C for 14 h. After 14 h the PVDF membranes were washed thrice with PBST and incubated with a secondary antibody at room temperature for 1 h. The signals were detected by chemiluminescence assay using a ChemiDoc Touch (Bio-Rad).

Cell viability assays

Briefly, cells were seeded into 96-well plates at an appropriate density and allowed to adhere overnight. The following day, cells were treated with various concentrations of the indicated drug and incubated for the desired time period. Subsequently, 10 μL of CCK-8 solution was added to each well and the plates were incubated at 37 °C for 1-2 hours. After incubation, absorbance was measured at 450 nm using a microplate reader.

Colony forming assay

MCF-7, T47D, and LCC2 cells were seeded in 6-well plates, exposed to the indicated treatments, and cultured for approximately 15 days, and the medium was changed every 3 days. After treatment, the cells were fixed with 4% paraformaldehyde, stained with crystal violet for 24 h, washed with water, and colonies were counted.

5-Ethynyl-2’- deoxyuridine Assay (EdU)

After treatment with Bufalin, LCC2 cells were incubated with 5-ethynyl-2′-deoxyuridine (EdU; RiboBio, Guangzhou, China) for 2 hours at 37 °C, according to the manufacturer’s instructions. The cells were fixed with 4% paraformaldehyde at room temperature for 30 min, followed by treatment with 2 mg/mL glycine for 5 min. Next, the cells were permeabilized with 0.5% Triton X-100 for 10 min and stained with a 1× Apollo reaction cocktail for 30 min in the dark at room temperature. Finally, cell nuclei were counterstained with Hoechst 33342 for 30 min at room temperature. Images were captured using a fluorescence microscope.

Quantitative Real-time PCR

Total RNA was isolated from cells using the TRIzol reagent (CWBio, Taizhou, China), and reverse transcription was carried out using the PrimeScript RT reagent kit (TaKaRa, Japan) to generate complementary DNA (cDNA). Quantitative real-time PCR was conducted on a QuantStudio Real-Time PCR System (Life Technologies) using QuantStudio Design & Analysis Software v1.5.1. Gene expression levels were quantified using the standard 2^−ΔΔCt method. The qPCR primer sets were: ESR1: GGGAAGTATGGCTATGGAATCTG (forward), TGGCTGGACACATATAGTCGTT (reverse); AGR2: AGAGCAGTTTGTCCTCCTCAA (forward), CAGGTTCGTAAGCATAGAGACG (reverse); CCND1: CAATGACCCCGCACGATTTC (forward), CATGGAGGGCGGATTGGAA (reverse); GREB1: TGGTCCGTAATGCACAAGGG (forward), CTGCGTTTAGTGAGGGGTGA (reverse); NRIP1: GGATCAGGTACTGCCGTTGAC (forward), CTGGACCATTACTTTGACAGGTG (reverse); PGR: TTATGGTGTCCTTACCTGTGGG (forward), GCGGATTTTATCAACGATGCAG (reverse); SIAH2: TCTTCGAGTGTCCGGTCTG (forward), CGGCATTGGTTACACACCAG (reverse), GAPDH: TGACATCAAGAAGGTGGTGAAGCAG (forward), GTGTCGCTGTTGAAGTCAGAGGAG (reverse).

Flow-cytometric analysis of apoptosis

After Bufalin treatment, the cells were collected and washed twice with cold PBS. Subsequently, 5 μL Annexin V-FITC and 5 μL propidium iodide (PI) staining buffer were added to the cells and incubated in the dark at room temperature. After 15 min, the stained cells were analyzed using FACS.

Immunofluorescence staining

MCF-7 cells treated with Biotin-Bufalin on glass coverslips were fixed in 4% paraformaldehyde for 30 min at room temperature and blocked with 5% bovine serum albumin (BSA) for 1 h. The fixed cells were then incubated with anti-ERα antibody and streptavidin FITC at 4 °C overnight, followed by Alexa Fluor 594 anti-rabbit IgG antibody. At the end of the incubation period, the cells’ nuclei were stained with DAPI, and the fluorescence signal was detected and captured using confocal microscopy.

Co-immunoprecipitation (Co-IP) assay

The 293 T cells were transiently transfected with Flag-ERα plasmid or HA-STUB1 and subjected to Bufalin treatment as indicated. After treatment, the cells were washed twice with PBS and lysed in mammalian protein extraction reagent buffer (cat. no. 78501; Thermo Scientific), supplemented with protease and phosphatase inhibitors for 30 min. Cell lysates were centrifuged, and supernatant was precleared with protein G agarose beads (Santa Cruz), then subjected to immunoprecipitation with indicated antibodies and protein A/G agarose beads at 4 °C overnight. The next day, the immunocomplexes were washed five times with PBS, and the binding proteins were eluted by 1 × SDS-PAGE loading buffer at 95 °C for 10 min. Bound proteins were identified using immunoblotting and western blot.

Biotin-pull down assay

After treatment, the cells were washed with PBS and lysed for 30 min in mammalian protein extraction (Thermo Scientific) with protease and phosphatase inhibitors. Following cell lysis, the supernatants were collected by centrifugation at 12,000 × g for 15 minutes at 4 °C. The streptavidin magnetic beads were pre-incubated with the cell lysate for 2 hours. Subsequently, 500 μg of clarified cell lysate was incubated with either D-Biotin or Biotin-Bufalin overnight at 4 °C for target protein capture. The following day, the mixture containing biotin and cell lysate was coupled with streptavidin magnetic beads (Beaver) for 2 hours at room temperature. The magnetic beads were then collected using a magnetic rack and washed six times to remove non-specifically bound proteins. Bound proteins were eluted by boiling in 1× SDS-PAGE loading buffer at 95 °C for 10 minutes, followed by detection via western blot analysis.

Animal studies

Briefly, the Tamoxifen-resistant cells LCC2 (2 × 10⁶ cells) were subcutaneously injected into 4-week-old female nude mice (Hunan Slack Jingda Laboratory Animal Co., Ltd.). Tumor sizes were measured on different days after inoculation and calculated using the formula V = lw²π/6, where l is the length and w is the width. When the tumors were palpable, the mice were randomly divided into designated groups and received the indicated treatments. The tumor volume was measured using a Vernier caliper every two days.

Immunohistochemistry (IHC)

The human cancer tissue specimens from patients with Tamoxifen treatment and recurrence, and animal tissue were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at a thickness of 4 μm. After deparaffinization, antigen retrieval was performed using a citric acid buffer (pH 6.0). Endogenous peroxidase activity was blocked with 3% hydrogen peroxide, and following blocked with the application of normal serum. Sections were then incubated overnight at 4 °C with the antibodies against ERα and Ki67, followed by HRP-conjugated secondary antibodies. The signal was developed using DAB, and the nuclei were counterstained with hematoxylin. Immunohistochemical staining was performed according to the manufacturer’s protocol.

Protein-ligand binding conformation modeling

The conformation of the protein-ligand complex was modeled using Schrödinger software (version 2022.1). The structure of Bufalin was obtained from PubChem, and ligand conformations were generated using LigPrep. The crystal structure of the ESR1 protein was obtained from the Protein Data Bank (PDB ID: 3ERT)⁶³. The Glide SP protocol was employed to generate the optimal conformation of the protein-ligand complex.

Protein-protein docking conformation modeling

The structures of STUB1, TRIM56, RNF181, RNF2, and ESR1 proteins were obtained from the Protein Data Bank and Alphafold 3, and subjected to 15 repeats of optimization using the relax module of Rosetta (version 3.5.1)⁶⁴. Ten conformations were generated from each optimization, and the top-scoring conformation from Rosetta was used for subsequent protein-protein docking. Initial protein-protein docking was performed using the ClusPro server⁶⁵. Complex conformations with incorrect STUB1, TRIM56, RNF181, and RNF2 binding modes were excluded from the ClusPro docking results. These conformations were subjected to structural refinement using the docking protocol of Rosetta. All generated conformations were ranked according to their Rosetta scores.

Molecular dynamic simulations

Molecular simulations of ESR1-Bufalin, ESR1-STUB1, and ESR1-Bufalin-STUB1 complexes were conducted using Amber22 software. Proteins and ligands were parameterized using Amber ff19SB⁶⁶ and GAFF2⁶⁷ force fields, respectively. The complex systems were solvated in a TIP3P water box extending 10 Å from the protein. Chloride and sodium ions were then added to neutralize the system. Subsequently, energy minimization was performed for up to 20,000 steps. The systems were heated from 0 K to 298.15 K over 100 ps and the pressure was increased to atmospheric pressure over another 100 ps, with a time step of 1 fs during the heating and pressurization processes. Finally, a 200 ns production classical MD simulation was conducted with a time step of 2 fs. Trajectory analysis was performed using CPPTRAJ.

MM-PBSA and alanine scanning mutations analysis

MM-PBSA binding free energy calculations were performed using MMPBSA.py from AmberTools2023⁶⁸, using only the last 100 ns of the trajectory. We extracted 100 frames from the trajectory for subsequent energy calculations. In addition, residual energy decomposition was performed for the Bufalin-ESR1 complex. Alanine scanning mutations⁶⁹ were conducted on the top ten residues from the energy decomposition analysis.

Surface Plasmon Resonance (SPR) assay

After storage at -80 °C, Bufalin and the recombinant proteins CYP17A1, ESR1, and PKC delta were allowed to equilibrate to room temperature. Bufalin was diluted with DMSO to the appropriate concentration for spotting and used as the immobilized phase. The working solution was printed onto a 3D photocrosslinkable sensor chip using the BioDot™ AD1520 microarray printer, with four nonadjacent replicate spots per compound. The printed chips were vacuum-dried and then subjected to UV-induced photocrosslinking using a crosslinking instrument. Following crosslinking, the chips were sequentially washed on a shaker with DMF, ethanol (EtOH), and deionized water for 15 minutes each. The recombinant protein samples were diluted to generate five concentration gradients: 200 nM, 400 nM, 800 nM, 1600 nM, and 3200 nM, and were injected over the chip surface. During interaction analysis, the protein analytes were passed over the chip surface at a flow rate of 0.5 μL/s. Each association phase lasted 600 seconds, followed by a 360-second dissociation phase. After each binding cycle, the chip surface was regenerated with 10 mM glycine-HCl (pH 2.0) at a flow rate of 2 μL/s to remove the bound analytes.

Patient-derived organoid

Tissue specimens from patients who relapsed after Tamoxifen therapy were processed for organoid culture according to previous protocols^70,71. Samples were obtained from the Xiangya Hospital of Central South University (Changsha, China), and written informed consent was obtained from all participants prior to collection. Tissue samples were enzymatically digested into single-cell suspensions using collagenase (Sigma) and subsequently cultured in a 3D environment composed of 50% chilled Matrigel (Corning). After 5 days of culture, the resulting organoids were dissociated into single-cell suspensions, seeded into 384-well plates, and treated with Bufalin. After 4 days of treatment, cell viability was assessed using CellTiter-Glo 3D Reagent (Promega) according to the manufacturer’s instructions.

Organoid live/dead cell staining

Live/dead organoid cell staining was performed as previously described⁷². Following treatment, the samples were washed twice with cold PBS and subsequently stained with Calcein-AM and propidium iodide (PI) at 37 °C for 20 minutes in the dark. Finally, the images were captured using a fluorescence microscope.

Statistics and reproducibility

We analyzed the data using GraphPad Prism 9.0 software. All samples represent biological replicates, and the statistical measurements are presented as mean ± SD as specified in each figure. No statistical method was used to predetermine sample size. No data were excluded from the analyses. The experiments were randomized. The Investigators were blinded to allocation during experiments and outcome assessment. Statistical analyses were performed using one-way or two-way ANOVA, depending on the experimental design. A P-value < 0.05 was considered statistically significant. The P values are given in the figures. All representative experiments are repeated at least three times independently with similar results.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.